Skip to main content
Addgene

p(+)MV-NSE-FlagrP-3g_haP-F497D-3p
(Plasmid #58800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58800 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p(+)MV-NSE-FlagP-M502-3p
  • Modifications to backbone
    Plasmid derived from p(+)MVNSe made in Roberto Cattaneo’s lab. p(+)MVNSe is derived from the original p(+)MV15894 plasmid described by Martin Billeter’s group in Radecke et al., EMBO J 14:5773 (1995) PMID:8846771. p(+)MV15894 contains the Edmonston molecular clone Genebank Z66517 with 13 point mutations including the “tag” AC>GA at positions 1818-9 of the genome, hence its acronym “Edm-tag” and a mutation in P gene resulting in 272Cyst>272Arg mutation into the V coding sequence that disable this protein. p(+)MVNSe is an elongated version of p(+)MV15894 containing the additional sequence CGTACGATGACGTCCTAG inserted just after nt 3368 to introduce unique restriction sites while preserving the genome length to compliance to the rule of six

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Top10
  • Growth instructions
    Transformed bacteria should never be stored at 4°C and should be kept growing at 30°C.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Measles virus antigenome
  • Species
    measles virus
  • Insert Size (bp)
    17784
  • Promoter T7
  • Tags / Fusion Proteins
    • Flag (N terminal on insert)
    • Ha (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGGTGAACTccatgcGAAC
  • 3′ sequencing primer TCTCTGTCATTGTGGAACTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Unique AatII site noted in the Modifications to Backbone field was confirmed by restriction digest. Please see Notes from Addgene link to view results.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p(+)MV-NSE-FlagrP-3g_haP-F497D-3p was a gift from Branka Horvat (Addgene plasmid # 58800 ; http://n2t.net/addgene:58800 ; RRID:Addgene_58800)
Commonly requested with: