p(+)MV-NSE-FlagP-F497D-3p
(Plasmid #58797)

• Purpose: Expresses recombinant measles virus with Flag-P-F497D gene tagged si2 (siP) target sequence
• Depositing Lab: Branka Horvat
• Publication: biG-biS plasmids (unpublished)

Backbone

• Vector backbone: p(+)MV15894
• Modifications to backbone: Plasmid derived from p(+)MVNSe made in Roberto Cattaneo’s lab. p(+)MVNSe is derived from the original p(+)MV15894 plasmid described by Martin Billeter’s group in Radecke et al., EMBO J 14:5773 (1995) PMID:8846771. p(+)MV15894 contains the Edmonston molecular clone Genebank Z66517 with 13 point mutations including the “tag” AC>GA at positions 1818-9 of the genome, hence its acronym “Edm-tag” and a mutation in P gene resulting in 272Cyst>272Arg mutation into the V coding sequence that disable this protein. p(+)MVNSe is an elongated version of p(+)MV15894 containing the additional sequence CGTACGATGACGTCCTAG inserted just after nt 3368 to introduce unique restriction sites while preserving the genome length to compliance to the rule of six

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Top10
• Growth instructions: Transformed bacteria should never be stored at 4°C and should be kept growing at 30°C.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Measles virus antigenome
• Species: measles virus
• Insert Size (bp): 15996
• Mutation: MeV-P F497D
• Promoter: T7
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AACCAGGTCCACACAGC
• 3′ sequencing primer: TCTCTGTCATTGTGGAACTT

Resource Information

• Supplemental Documents:
  • Features p(+)MV-NSE-FlagP-F497D-3p
• Addgene Notes:
  • Plasmid 58797 digest
• A portion of this plasmid was derived from a plasmid made by: Original plasmid construct used as backbone was provided by Roberto Cattaneo and Martin Billeter.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Unique AatII site noted in the Modifications to Backbone field was confirmed by restriction digest. Please see Notes from Addgene link to view results.