Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMRX-IP/SECFP-mDFCP1
(Plasmid #58765)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58765 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMRXIP SECFP-Ci2
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6600
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZFYVE1 zinc finger, FYVE domain containing 1
  • Alt name
    DFCP1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2331
  • GenBank ID
    NM_183154.3
  • Entrez Gene
    Zfyve1 (a.k.a. DFCP1, G630053K23, TAFF1, ZNFN2A1, mKIAA1589)
  • Tag / Fusion Protein
    • SECFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAAGACGGCAATATGGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-IP/SECFP-mDFCP1 was a gift from Noboru Mizushima (Addgene plasmid # 58765 ; http://n2t.net/addgene:58765 ; RRID:Addgene_58765)
  • For your References section:

    Temporal analysis of recruitment of mammalian ATG proteins to the autophagosome formation site. Koyama-Honda I, Itakura E, Fujiwara TK, Mizushima N. Autophagy. 2013 Oct;9(10):1491-9. doi: 10.4161/auto.25529. Epub 2013 Jul 10. 10.4161/auto.25529 PubMed 23884233