pLKO.1 shPIK3CD.v2 puro
(Plasmid #58707)

• Purpose: Lentiviral shRNA vector for knockdown of human PIK3CD
• Depositing Lab: Kevin Janes
• Publication: Bajikar et al Proc Natl Acad Sci U S A. 2014 Feb 4;111(5):E626-35. doi: 10.1073/pnas.1311647111. Epub 2014 Jan 21.

Backbone

• Vector backbone: pLKO.1
• Backbone manufacturer: Weinberg Lab (Addgene plasmid 8453)
• Total vector size (bp): 7032
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shPIK3CD
• gRNA/shRNA sequence: CCGGGACCCAGAAGTGAACGACTTTCTGCAGAAAGTTCACTTCTGGGTCTTTTTG
• Species: H. sapiens (human)
• GenBank ID: NM_005026
• Entrez Gene: PIK3CD (a.k.a. APDS, IMD14, IMD14A, IMD14B, P110DELTA, PI3K, ROCHIS, p110D)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: LKO.1 5'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The primers were generated by the TRC (#TRCN0000033276) Construct mildly knocks down p110d (PIK3CD) protein expression ~2 fold after 3 X 500 uL infection in MCF10A-5E cells.

The specificity of this construct has not been confirmed by addback, but a second hairpin against the same target yielded the same phenotype.