pTRF.1 udsVenus (P_JUND)
(Plasmid #58692)

• Purpose: A rapidly responsive reporter of endogenous JUND promoter activity (Lentiviral expression vector for reporter ultradestabilized Venus)
• Depositing Lab: Kevin Janes
• Publication: Wang et al Nat Cell Biol. 2014 Apr;16(4):345-56. doi: 10.1038/ncb2930. Epub 2014 Mar 23.

Backbone

• Vector backbone: pTRF.1-mCMV-udsVenus
• Backbone size w/o insert (bp): 6223
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: endogenous promoter of JUND
• Species: H. sapiens (human)
• Insert Size (bp): 2159
• Entrez Gene: JUND (a.k.a. AP-1)
• Tag / Fusion Protein:
  • udsVenus (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: AGAAGAGGTAGGATAGGAGGGATG
• 3′ sequencing primer: gcgcaagcttcccgcg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments