Skip to main content
Addgene

HSC1-D4Z4-GiP
(Plasmid #58542)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58542 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    HSC1 retroviral vector
  • Backbone size w/o insert (bp) 4941
  • Total vector size (bp) 9251
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Enhanced Green Fluorescence Protein, Puromycin resistance gene
  • Alt name
    EiP
  • Insert Size (bp)
    1945
  • Promoter Human EF1-alpha

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer cgggaacctcaagatggata
  • 3′ sequencing primer ccatatgatcgatgcatggg
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    D4Z4 repeat, partial
  • Species
    H. sapiens (human)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ctcgatcctccctttatcca
  • 3′ sequencing primer tcctttcaagacctagaagg
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HSC1-D4Z4-GiP was a gift from James Ellis (Addgene plasmid # 58542 ; http://n2t.net/addgene:58542 ; RRID:Addgene_58542)

  • For your References section:

    Kinetics and epigenetics of retroviral silencing in mouse embryonic stem cells defined by deletion of the D4Z4 element. Rival-Gervier S, Lo MY, Khattak S, Pasceri P, Lorincz MC, Ellis J. Mol Ther. 2013 Aug;21(8):1536-50. doi: 10.1038/mt.2013.131. Epub 2013 Jun 11. 10.1038/mt.2013.131 PubMed 23752310
Related items:
Commonly requested with: