HSC1-HS4-GiP
(Plasmid #58540)

• Purpose: Derived from HSC1-GiP where 2 copies of the HS4 insulator core are cloned inside the 3'LTR
• Depositing Lab: James Ellis
• Publication: Rival-Gervier et al Mol Ther. 2013 Aug;21(8):1536-50. doi: 10.1038/mt.2013.131. Epub 2013 Jun 11.

Backbone

• Vector backbone: HSC1 retroviral vector
• Backbone size w/o insert (bp): 4941
• Total vector size (bp): 8805
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Enhanced Green Fluorescence Protein, Puromycin resistance gene
• Alt name: EiP
• Insert Size (bp): 1945
• Promoter: Human EF1-alpha

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ctcgatcctccctttatcca
• 3′ sequencing primer: ccatatgatcgatgcatggg

Gene/Insert 2

• Gene/Insert name: Core HS4 insulator sequence (dimer)
• Species: G. gallus (chicken)
• Insert Size (bp): 526

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: cccatgcatcgatcatatgg
• 3′ sequencing primer: ctgttacccatgaaagaccc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry