p007ampGFP
(Plasmid
#58535)
-
PurposeGFP from jellyfish Aquorea sp. under T5 promoter with lac operators; ampicillin resistant.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJ401
- Backbone size w/o insert (bp) 3979
- Total vector size (bp) 4696
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
SpeciesAquorea victoria
-
Insert Size (bp)717
- Promoter T5 between two lac operators
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAGT
- 3′ sequencing primer CTCAGAAGTGAAACGCCGTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDNA2.0, with GFP coming from another plasmid, pET EDNA
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative name: p007-amp-GFP-T5lac Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p007ampGFP was a gift from Jaroslaw Bryk (Addgene plasmid # 58535 ; http://n2t.net/addgene:58535 ; RRID:Addgene_58535) -
For your References section:
UNIGEMS: plasmids and parts to facilitate teaching on assembly, gene expression control and logic in E. coli. Siddall A, Williams AA, Sanders J, Denton JA, Madden D, Schollar J, Bryk J. bioRxiv 2021.06.20.449138 10.1101/2021.06.20.449138