p005kanRFP
(Plasmid
#58533)
-
PurposeRFP from coral Corynactis sp. under T5 promoter with lac operators; kanamycin resistant.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJ401
-
Backbone manufacturerDNA20
- Backbone size w/o insert (bp) 3929
- Total vector size (bp) 4610
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRed fluorescent protein
-
Alt nameRFP
-
SpeciesCorynactis sp.
-
Insert Size (bp)681
- Promoter T5 between two lac operators
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAGT
- 3′ sequencing primer CTCAGAAGTGAAACGCCGTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom DNA2.0
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative name: p005-kan-RFP-T5lac Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p005kanRFP was a gift from Jaroslaw Bryk (Addgene plasmid # 58533 ; http://n2t.net/addgene:58533 ; RRID:Addgene_58533) -
For your References section:
UNIGEMS: plasmids and parts to facilitate teaching on assembly, gene expression control and logic in E. coli. Siddall A, Williams AA, Sanders J, Denton JA, Madden D, Schollar J, Bryk J. bioRxiv 2021.06.20.449138 10.1101/2021.06.20.449138