VV247: sdChR(C138S)-TS-GCaMP6f-ER in fck
(Plasmid #58522)

• Purpose: Expresses sdChR(C138S) fused to GCaMP6f in mammalian cells
• Depositing Lab: Adam Cohen
• Publication: Venkatachalam et al Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020.

Backbone

• Vector backbone: FCK(1.3)GW, from Addgene 22217
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10059
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sdChR(C138S)-TS-GCaMP6f-ER
• Alt name: Channelrhodopsin from Scherffelia dubia
• Species: Scherffelia dubia
• Insert Size (bp): 2420
• Mutation: changed Cysteine 138 to Serine
• Promoter: a-CamKII
• Tag / Fusion Protein:
  • GCaMP6f (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCTCGTCAATCAAGCTGGTTC
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We originally received this gene (sdChR) from Nathan Klapoetke in the Boyden Lab at MIT. We made the C138S point mutation in sdChR. Note that C138 in sdChR is homologous to C128 in ChR2; the ChR2(C128S) point mutant was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.) The calcium sensor GCaMP6f (see Addgene plasmid 40755) was obtained from Loren Looger and Douglas Kim.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sdChR was first published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.

GCaMP6f was published in: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354.)