Skip to main content
Addgene

VV221: sdChR(C138S)-TS-eGFP-ER in fck
(Plasmid #58513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58513 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FCK(1.3)GW, from Addgene 22217
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 10059
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sdChR(C138S)-TS-eGFP-ER
  • Alt name
    Channelrhodopsin from Scherffelia dubia
  • Species
    Scherffelia dubia
  • Insert Size (bp)
    1780
  • Mutation
    changed Cysteine 138 to Serine
  • Promoter a-CamKII
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received this gene (sdChR) from Nathan Klapoetke in the Boyden Lab at MIT; we made the C138S point mutation in sdChR and cloned it into the fck vector. Note that C138 in sdChR is homologous to C128 in ChR2; the ChR2(C128S) point mutant was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sdChR was published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV221: sdChR(C138S)-TS-eGFP-ER in fck was a gift from Adam Cohen (Addgene plasmid # 58513 ; http://n2t.net/addgene:58513 ; RRID:Addgene_58513)
  • For your References section:

    Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307