VV220: CoChR(C108S)-eGFP in fck
(Plasmid #58512)

• Purpose: Expresses CoChR with the C108S (step function opsin) mutation fused to eGFP under the a-CamKII promoter
• Depositing Lab: Adam Cohen
• Publication: Venkatachalam et al Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020.

Backbone

• Vector backbone: FCK(1.3)GW, from Addgene 22217
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10059
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CoChR(C108S)-eGFP
• Alt name: Channelrhodopsin from Chloromonas oogama
• Species: Chloromonas oogama
• Insert Size (bp): 1600
• Mutation: changed Cysteine 108 to Serine
• Promoter: a-CamKII
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCTCGTCAATCAAGCTGGTTC
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We received this gene (CoChR) from Nathan Klapoetke in the Boyden Lab at MIT; we made the C108S point mutation in CoChR and cloned it into the fck vector. Note that C108 in CoChR is homologous to the C128 in ChR2; the ChR2(C128S) was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CoChR was published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.