Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

VV201: ChR2(C128S)-eGFP in fubi
(Plasmid #58510)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58510 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FUGW (from Addgene plasmid 22051)
  • Backbone manufacturer
    Addgene plasmid 22051
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 10700
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChR2(C128S)-eGFP
  • Alt name
    Channelrhodopsin-2
  • Species
    C. reinhardtii
  • Insert Size (bp)
    1662
  • Mutation
    Changed Cysteine 128 to Serine
  • GenBank ID
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tcttcttaagtagctgaagctccg
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received this gene (ChR2) from the Boyden Lab at MIT; we made the C128S point mutation in ChR2. Note that this point mutation was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see Addgene plasmid 20294 (pLenti-CaMKIIa-hChR2(C128S)-EYFP-WPRE) for the original version of this gene (under the CamKII promoter).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV201: ChR2(C128S)-eGFP in fubi was a gift from Adam Cohen (Addgene plasmid # 58510 ; http://n2t.net/addgene:58510 ; RRID:Addgene_58510)
  • For your References section:

    Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307