VV201: ChR2(C128S)-eGFP in fubi
(Plasmid #58510)

• Purpose: Expresses channelrhodopsin-2 with the C128S (step function opsin) mutation fused to eGFP under the ubiquitin promoter
• Depositing Lab: Adam Cohen
• Publication: Venkatachalam et al Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020.

Backbone

• Vector backbone: FUGW (from Addgene plasmid 22051)
• Backbone manufacturer: Addgene plasmid 22051
• Backbone size w/o insert (bp): 9200
• Total vector size (bp): 10700
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ChR2(C128S)-eGFP
• Alt name: Channelrhodopsin-2
• Species: C. reinhardtii
• Insert Size (bp): 1662
• Mutation: Changed Cysteine 128 to Serine
• GenBank ID:
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: tcttcttaagtagctgaagctccg
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We received this gene (ChR2) from the Boyden Lab at MIT; we made the C128S point mutation in ChR2. Note that this point mutation was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see Addgene plasmid 20294 (pLenti-CaMKIIa-hChR2(C128S)-EYFP-WPRE) for the original version of this gene (under the CamKII promoter).