VV073: 1xCox8 - GCaMP5G in fubi
(Plasmid #58509)

• Purpose: Expresses the calcium sensor GCaMP5G in the mitochondria
• Depositing Lab: Adam Cohen
• Publication: Venkatachalam et al Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020.

Backbone

• Vector backbone: FCK(1.3)GW, from Addgene 22217
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10059
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 1xCox8 - GCaMP5G
• Species: R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
• Insert Size (bp): 1458
• GenBank ID:
• Promoter: a-CamKII

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCTCGTCAATCAAGCTGGTTC
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The Cox8 mitochondrial targeting sequence was amplified from Addgene plasmid 23348, mito-PAGFP. The calcium sensor GCaMP5G (Addgene plasmid 31788) was obtained from Loren Looger, Douglas Kim, and Jasper Akerboom.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see Addgene plasmid 31788 for more information on GCaMP5G; also note that GCaMP5G was published in: Optimization of a GCaMP calcium indicator for neural activity imaging. Akerboom et al (J Neurosci. 2012 Oct 3;32(40):13819-40. doi: 10.1523/JNEUROSCI.2601-12.2012.)