VV063: 1xCox8 - superecliptic pHluorin in fck
(Plasmid #58500)

• Purpose: Expresses the pH sensor superecliptic pHluorin in the mitochondria of mammalian cells
• Depositing Lab: Adam Cohen
• Publication: Venkatachalam et al Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020.

Backbone

• Vector backbone: FCK(1.3)GW, from Addgene 22217
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10059
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 1xCox8 - Superecliptic pHluorin
• Species: Synthetic
• Insert Size (bp): 820
• GenBank ID: AY533296
• Promoter: a-CamKII

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCTCGTCAATCAAGCTGGTTC
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The Cox8 mitochondrial targeting sequence was amplified from Addgene plasmid 23348, mito-PAGFP). The gene, superecliptic pHluorin, was originally obtained from Gero Miesenbock, at Memorial Sloan-Kettering Cancer Center, New York in the pGEX2T vector.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We obtained the gene for superecliptic pHluorin from the lab of Gero Miesenbock. Superecliptic pHluorin was first published (I believe) in: Ng, Roorda, et al. “Transmission of olfactory information between three population of neurons in the antennal lobe of the fly.” Neuron, 2002. 36(3): 463-74.