Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FRP793_insul-(lexA-box)4-PminCYC1-Citrine-TCYC1
(Plasmid #58434)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58434 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS-derived
  • Backbone manufacturer
    Robert Gnuegge
  • Backbone size w/o insert (bp) 4663
  • Total vector size (bp) 6084
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CitrineA206K
  • Species
    Synthetic
  • Insert Size (bp)
    1421
  • Promoter insul-(lexA-box)4-PminCYC1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer AATTAACCCTCACTAAAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For integration in yeast, linearize plasmid with PacI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FRP793_insul-(lexA-box)4-PminCYC1-Citrine-TCYC1 was a gift from Joerg Stelling (Addgene plasmid # 58434 ; http://n2t.net/addgene:58434 ; RRID:Addgene_58434)
  • For your References section:

    Inducible, tightly regulated and growth condition-independent transcription factor in Saccharomyces cerevisiae. Ottoz DS, Rudolf F, Stelling J. Nucleic Acids Res. 2014 Jul 17. pii: gku616. 10.1093/nar/gku616 PubMed 25034689