Skip to main content
Addgene

pclbw-eGFPomp25
(Plasmid #58424)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58424 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pclBW
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eGFP-omp25
  • Alt name
    Green fluorescent protein fused to C-terminus of OMP25
  • Alt name
    synaptojanin-2-binding protein
  • Species
    M. musculus (mouse)
  • Mutation
    contains aa's 109-145 of mouse omp25
  • Entrez Gene
    Synj2bp (a.k.a. ARIP2, ActRIP4, D12Wsu118e, OMP25)
  • Promoter CMV/b-actin
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer TCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer AGCAGCGTATCCACATAGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pclbw-eGFPomp25 was a gift from David Chan (Addgene plasmid # 58424 ; http://n2t.net/addgene:58424 ; RRID:Addgene_58424)

  • For your References section:

    Proteolytic cleavage of Opa1 stimulates mitochondrial inner membrane fusion and couples fusion to oxidative phosphorylation. Mishra P, Carelli V, Manfredi G, Chan DC. Cell Metab. 2014 Apr 1;19(4):630-41. doi: 10.1016/j.cmet.2014.03.011. 10.1016/j.cmet.2014.03.011 PubMed 24703695
Related items:
Commonly requested with: