pCMV-HA-mIFITM1-C103A
(Plasmid
#58419)
-
PurposeExpresses murine IFITM1-C103A with an N-terminal HA tag in mammalian cells.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-HA
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4118
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM1
-
SpeciesM. musculus (mouse)
-
MutationCysteine 103 to Alanine
-
Entrez GeneIfitm1 (a.k.a. 1110036C17Rik, DSPA2a, Mil-2, Mil2)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA-mIFITM1-C103A was a gift from Jacob Yount (Addgene plasmid # 58419 ; http://n2t.net/addgene:58419 ; RRID:Addgene_58419) -
For your References section:
Palmitoylation on conserved and nonconserved cysteines of murine IFITM1 regulates its stability and anti-influenza A virus activity. Hach JC, McMichael T, Chesarino NM, Yount JS. J Virol. 2013 Sep;87(17):9923-7. doi: 10.1128/JVI.00621-13. Epub 2013 Jun 26. 10.1128/JVI.00621-13 PubMed 23804635