pCMV-Myr-HA-mIFITM3-C71,72,105A-CLVL
(Plasmid #58414)

• Purpose: Expresses murine IFITM3-C71,72,105A with an N-terminal myristoylation sequence from HIV Gag followed by an HA tag, as well as a C-terminal CaaX prenylation motif, in mammalian cells
• Depositing Labs: Howard Hang, Jacob Yount
• Publication: Yount et al J Biol Chem. 2012 Jun 1;287(23):19631-41. doi: 10.1074/jbc.M112.362095. Epub 2012 Apr 17.

Backbone

• Vector backbone: pCMV-HA
• Backbone manufacturer: clontech
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 4250
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IFITM3
• Species: M. musculus (mouse)
• Mutation: Cysteines 71, 72, and 105 to Alanine; The sequence GARASVLS was added prior to the HA tag within the vector; The sequence CLVL was added at the C-terminus
• Entrez Gene: Ifitm3 (a.k.a. 1110004C05Rik, Cd225, Cdw217, DSPA2b, Fgls, IP15, mil-1)
• Promoter: CMV IE
• Tag / Fusion Protein:
  • HA internal

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GATCCGGTACTAGAGGAACTGAAAAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry