Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-HA-mIFITM3-K24A
(Plasmid #58400)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58400 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-HA
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4211
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFITM3
  • Species
    M. musculus (mouse)
  • Mutation
    Lysine 24 to Alanine
  • Entrez Gene
    Ifitm3 (a.k.a. 1110004C05Rik, Cd225, Cdw217, DSPA2b, Fgls, IP15, mil-1)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HA-mIFITM3-K24A was a gift from Howard Hang & Jacob Yount (Addgene plasmid # 58400 ; http://n2t.net/addgene:58400 ; RRID:Addgene_58400)
  • For your References section:

    S-palmitoylation and ubiquitination differentially regulate interferon-induced transmembrane protein 3 (IFITM3)-mediated resistance to influenza virus. Yount JS, Karssemeijer RA, Hang HC. J Biol Chem. 2012 Jun 1;287(23):19631-41. doi: 10.1074/jbc.M112.362095. Epub 2012 Apr 17. 10.1074/jbc.M112.362095 PubMed 22511783