pIHEU-MCS
(Plasmid
#58375)
-
Purpose(Empty Backbone) UAS vector to express gene of interest in Drosophila
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAPIC
-
Modifications to backbonecontains 5xUAS-Hsp70-Intron-MCS (9863 bp) cloned into SphI/XhaI sites.
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer aattgtgctcggcaacagc
- 3′ sequencing primer ggcgcacagaaatgattacaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIHEU-MCS was a gift from Chun Han (Addgene plasmid # 58375 ; http://n2t.net/addgene:58375 ; RRID:Addgene_58375) -
For your References section:
Phosphatidylserine Externalization Results from and Causes Neurite Degeneration in Drosophila. Sapar ML, Ji H, Wang B, Poe AR, Dubey K, Ren X, Ni JQ, Han C. Cell Rep. 2018 Aug 28;24(9):2273-2286. doi: 10.1016/j.celrep.2018.07.095. 10.1016/j.celrep.2018.07.095 PubMed 30157423