pACU
(Plasmid #58373)

• Purpose: (Empty Backbone) UAS vector to express gene of interest in Drosophila
• Depositing Labs: Chun Han, Yuh-Nung Jan
• Publication: Han et al Proc Natl Acad Sci U S A. 2011 May 23. ():.

Backbone

• Vector backbone: pUAST
• Modifications to backbone: The attB fragment isolated from pAttB by SalI digestion was inserted into the NdeI site of pUAST by blunt ligation.
• Vector type: Insect Expression
• Selectable markers: mini-white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: tactccacctcacccatctg
• 3′ sequencing primer: atgatggaccagatgggtgag

Resource Information

• Supplemental Documents:
  • pACU annotated GenBank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.