Skip to main content
Addgene

pUA
(Plasmid #58372)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58372 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUAST-attB
  • Modifications to backbone
    A 500 pb DNA fragment containing 10X UAS and hsp70 core promoter was obtained from pMF3 (Dietzl et al., 2007) by restriction digestion and used to replace the 5X UAS-hsp70 fragment in pUAST-attB (Bischof et al., 2007).
  • Vector type
    Insect Expression
  • Selectable markers
    mini-white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tgcaactactgaaatctgcc
  • 3′ sequencing primer gtttgtccaattatgtcacacc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUA was a gift from Chun Han & Yuh-Nung Jan (Addgene plasmid # 58372 ; http://n2t.net/addgene:58372 ; RRID:Addgene_58372)

  • For your References section:

    Epidermal cells are the primary phagocytes in the fragmentation and clearance of degenerating dendrites in Drosophila. Han C, Song Y, Xiao H, Wang D, Franc NC, Jan LY, Jan YN. Neuron. 2014 Feb 5;81(3):544-60. doi: 10.1016/j.neuron.2013.11.021. Epub 2014 Jan 9. 10.1016/j.neuron.2013.11.021 PubMed 24412417
Related items:
Commonly requested with: