pWaldo-GFPe_PepTSo
(Plasmid #58334)

• Purpose: Expresses the POT family transporter from Shewanella oniedensis in E. coli as a C-terminally tagged GFP his tagged protein
• Depositing Labs: So Iwata, Simon Newstead
• Publication: Newstead et al EMBO J. 2011 Jan 19;30(2):417-26. doi: 10.1038/emboj.2010.309. Epub 2010 Dec 3.

Backbone

• Vector backbone: pWALDOe
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 7000
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: for expression use C43 (DE3) bacteria, grow cells at 37°C until induction with IPTG, then grow at 25 °C
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PepTso
• Species: Shewanella oneidensis
• Insert Size (bp): 1500
• Promoter: T7
• Tag / Fusion Protein:
  • GFP-His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (destroyed during cloning)
• 5′ sequencing primer: T7 forward
• 3′ sequencing primer: GAAAAGTTCTCCTCCTTTGCT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry