-
PurposeExpresses human XPO5 on the C-terminus of eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepeGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExportin-5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3615
-
Entrez GeneXPO5 (a.k.a. exp5)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATGGCGATGGATCAAGTAAAC
- 3′ sequencing primer TCAGGGTTCAAAGATGGTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
peGFP-XPO5 was a gift from Matthew Wood (Addgene plasmid # 58331 ; http://n2t.net/addgene:58331 ; RRID:Addgene_58331) -
For your References section:
Artificial mirtron-mediated gene knockdown: functional DMPK silencing in mammalian cells. Seow Y, Sibley CR, Wood MJ. RNA. 2012 Jul;18(7):1328-37. doi: 10.1261/rna.030601.111. Epub 2012 May 30. 10.1261/rna.030601.111 PubMed 22647847