pUWR-CadTS-C
(Plasmid
#58326)
-
PurposeDestination vector for inserting ubi-CadTS control to Drosophila melanogaster genome
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58326 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUWR
-
Backbone manufacturerClara Moch at Jean-Rene Huynh's Laboratory
- Backbone size w/o insert (bp) 12396
- Total vector size (bp) 18495
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE-cadherin tension sensor control
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)6099
-
GenBank IDKJ826436
- Promoter poly-ubiquitin
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCAGCCAGGAAGTTAGTT
- 3′ sequencing primer GGACAGCTTCAAGTAGTCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUWR-CadTS-C was a gift from Denise Montell (Addgene plasmid # 58326 ; http://n2t.net/addgene:58326 ; RRID:Addgene_58326) -
For your References section:
Mechanical Feedback through E-Cadherin Promotes Direction Sensing during Collective Cell Migration. Cai D, Chen SC, Prasad M, He L, Wang X, Choesmel-Cadamuro V, Sawyer JK, Danuser G, Montell DJ. Cell. 2014 May 22;157(5):1146-59. doi: 10.1016/j.cell.2014.03.045. 10.1016/j.cell.2014.03.045 PubMed 24855950
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/58/58326/58326-map_IEq1-fxsU0XP.png.940x940_q85_autocrop.png)