pLVX-FADD-DD
(Plasmid #58263)

• Purpose: Lentiviral vector for expressing a truncated form of FADD (lack of death effector domain) in mammalian cells
• Depositing Lab: Joan Massague
• Publication: Valiente et al Cell. 2014 Feb 27;156(5):1002-16. doi: 10.1016/j.cell.2014.01.040.

Backbone

• Vector backbone: pLVX-IRES-Hygro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8519
• Total vector size (bp): 8924
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FADD
• Species: H. sapiens (human)
• Insert Size (bp): 405
• Mutation: version of FADD (FADD-DD) that contains the FADD death domain (aa30-124), but lacks the death effector domain that binds to caspase-8
• GenBank ID: NM_003824.3
• Entrez Gene: FADD (a.k.a. GIG3, IMD90, MORT1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GCAGAGCTCGTTTAGTGAACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Andrew M. Thorburn Professor and Vice Chair, Dept. of Pharmacology University of Colorado Denver Department of Pharmacology
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry