HSC1-GiP
(Plasmid #58254)

• Purpose: This self-inactivated retroviral vector has an internal human EF1alpha promoter driving the expression of a bicistronic EGFP ires Puromycin cassette
• Depositing Lab: James Ellis
• Publication: Rival-Gervier et al Mol Ther. 2013 Aug;21(8):1536-50. doi: 10.1038/mt.2013.131. Epub 2013 Jun 11.

Backbone

• Vector backbone: HSC1 retroviral vector
• Backbone size w/o insert (bp): 4941
• Total vector size (bp): 8075
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Enhanced Green Fluorescence Protein, Puromycin resistance gene
• Alt name: EiP
• Insert Size (bp): 1945
• Promoter: Human EF1-alpha

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: gccggaattcgttaacctca
• 3′ sequencing primer: ccatatgatcgatgcatggg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there is a small deletion (32bp) just after the 3’LTR inside the cloning vector that removes the M13R primer region. The depositing lab was able to produce viruses with good titer and doesn’t think the missing 32bp is a major concern.