retro-gfpIkkb-puro vector
(Plasmid
#58251)
-
PurposeRetroviral expression vector encoding bicistronic EGFP-IKKbeta and Puromycin cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneretro-puro vector
-
Backbone manufacturerStathopoulos Lab (Addgene plasmid #58250)
- Backbone size w/o insert (bp) 7432
- Total vector size (bp) 9779
-
Modifications to backboneAgeI and HpaI digestion
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIkkβ
-
Alt nameIkbkb
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001159774.1
-
Entrez GeneIkbkb (a.k.a. IKK-2, IKK-B, IKK-beta, IKK2, IKK[b], IKKbeta, NFKBIKB)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer AGCCCTCACTCCTTCTCTAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The EGFP-Ikkb insert of this plasmid was taken by Age I and HpaI digestion from a pEGFP-C1 plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
retro-gfpIkkb-puro vector was a gift from Georgios Stathopoulos (Addgene plasmid # 58251 ; http://n2t.net/addgene:58251 ; RRID:Addgene_58251) -
For your References section:
Mast cells mediate malignant pleural effusion formation. Giannou AD, Marazioti A, Spella M, Kanellakis NI, Apostolopoulou H, Psallidas I, Prijovich ZM, Vreka M, Zazara DE, Lilis I, Papaleonidopoulos V, Kairi CA, Patmanidi AL, Giopanou I, Spiropoulou N, Harokopos V, Aidinis V, Spyratos D, Teliousi S, Papadaki H, Taraviras S, Snyder LA, Eickelberg O, Kardamakis D, Iwakura Y, Feyerabend TB, Rodewald HR, Kalomenidis I, Blackwell TS, Agalioti T, Stathopoulos GT. J Clin Invest. 2015 Jun;125(6):2317-34. doi: 10.1172/JCI79840. Epub 2015 Apr 27. 10.1172/JCI79840 PubMed 25915587