Skip to main content
Addgene

retro-gfp-puro vector
(Plasmid #58249)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58249 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    retro-puro vector
  • Backbone manufacturer
    Stathopoulos Lab (Addgene plasmid #58250)
  • Backbone size w/o insert (bp) 6691
  • Total vector size (bp) 7432
  • Modifications to backbone
    Bgl II and XhoI digestion
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    Aequoria victoria
  • Insert Size (bp)
    747
  • GenBank ID
    L29345

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGCCCTCACTCCTTCTCTAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The EGFP insert of this plasmid was taken by BamHI and XhoI digestion from a TOPO II plasmid where the EGFP gene (extracted from EGFP-N1) was inserted into the MIGR1 backbone digested by BamHI and XhoI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    retro-gfp-puro vector was a gift from Georgios Stathopoulos (Addgene plasmid # 58249 ; http://n2t.net/addgene:58249 ; RRID:Addgene_58249)

  • For your References section:

    Mast cells mediate malignant pleural effusion formation. Giannou AD, Marazioti A, Spella M, Kanellakis NI, Apostolopoulou H, Psallidas I, Prijovich ZM, Vreka M, Zazara DE, Lilis I, Papaleonidopoulos V, Kairi CA, Patmanidi AL, Giopanou I, Spiropoulou N, Harokopos V, Aidinis V, Spyratos D, Teliousi S, Papadaki H, Taraviras S, Snyder LA, Eickelberg O, Kardamakis D, Iwakura Y, Feyerabend TB, Rodewald HR, Kalomenidis I, Blackwell TS, Agalioti T, Stathopoulos GT. J Clin Invest. 2015 Jun;125(6):2317-34. doi: 10.1172/JCI79840. Epub 2015 Apr 27. 10.1172/JCI79840 PubMed 25915587
Related items:
Commonly requested with: