pSpp1-is2
(Plasmid
#58248)
-
PurposeExpression vector producing isoform 2 derived mouse osteopontin (EGFP tagged)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5626
-
Modifications to backboneSal-XbaI digestion for cloning Sal-XhoI digestion and religation subsequent to cloning
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpp1-is2
-
Alt nameosteopontin isoform 2
-
Alt nameOpn
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)948
-
GenBank IDNM_001204202.1 NP_001191131.1
-
Entrez GeneSpp1 (a.k.a. 2AR, Apl-1, BNSP, BSPI, Bsp, ETA-1, Eta, OP, Opn, Opnl, Ric, Spp-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer catggtcctgctggagttcgtg
- 3′ sequencing primer cagccataccacatttgtagag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert of this plasmid was cloned originaly in our laboratory via RT-PCR from MC38 RNA. The PCR product was insterted into pGEM-T-EASY vector first and subcloned into pEGFP-C1 in frame to EGFP tag.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpp1-is2 was a gift from Georgios Stathopoulos (Addgene plasmid # 58248 ; http://n2t.net/addgene:58248 ; RRID:Addgene_58248) -
For your References section:
Mast cells mediate malignant pleural effusion formation. Giannou AD, Marazioti A, Spella M, Kanellakis NI, Apostolopoulou H, Psallidas I, Prijovich ZM, Vreka M, Zazara DE, Lilis I, Papaleonidopoulos V, Kairi CA, Patmanidi AL, Giopanou I, Spiropoulou N, Harokopos V, Aidinis V, Spyratos D, Teliousi S, Papadaki H, Taraviras S, Snyder LA, Eickelberg O, Kardamakis D, Iwakura Y, Feyerabend TB, Rodewald HR, Kalomenidis I, Blackwell TS, Agalioti T, Stathopoulos GT. J Clin Invest. 2015 Jun;125(6):2317-34. doi: 10.1172/JCI79840. Epub 2015 Apr 27. 10.1172/JCI79840 PubMed 25915587