Skip to main content
Addgene

pSpp1-is2
(Plasmid #58248)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58248 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5626
  • Modifications to backbone
    Sal-XbaI digestion for cloning Sal-XhoI digestion and religation subsequent to cloning
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Spp1-is2
  • Alt name
    osteopontin isoform 2
  • Alt name
    Opn
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    948
  • GenBank ID
    NM_001204202.1 NP_001191131.1
  • Entrez Gene
    Spp1 (a.k.a. 2AR, Apl-1, BNSP, BSPI, Bsp, ETA-1, Eta, OP, Opn, Opnl, Ric, Spp-1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer catggtcctgctggagttcgtg
  • 3′ sequencing primer cagccataccacatttgtagag
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert of this plasmid was cloned originaly in our laboratory via RT-PCR from MC38 RNA. The PCR product was insterted into pGEM-T-EASY vector first and subcloned into pEGFP-C1 in frame to EGFP tag.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpp1-is2 was a gift from Georgios Stathopoulos (Addgene plasmid # 58248 ; http://n2t.net/addgene:58248 ; RRID:Addgene_58248)

  • For your References section:

    Mast cells mediate malignant pleural effusion formation. Giannou AD, Marazioti A, Spella M, Kanellakis NI, Apostolopoulou H, Psallidas I, Prijovich ZM, Vreka M, Zazara DE, Lilis I, Papaleonidopoulos V, Kairi CA, Patmanidi AL, Giopanou I, Spiropoulou N, Harokopos V, Aidinis V, Spyratos D, Teliousi S, Papadaki H, Taraviras S, Snyder LA, Eickelberg O, Kardamakis D, Iwakura Y, Feyerabend TB, Rodewald HR, Kalomenidis I, Blackwell TS, Agalioti T, Stathopoulos GT. J Clin Invest. 2015 Jun;125(6):2317-34. doi: 10.1172/JCI79840. Epub 2015 Apr 27. 10.1172/JCI79840 PubMed 25915587
Related items:
Commonly requested with: