pMIR-His-Halo-Tev-PTEN
(Plasmid #58241)

• Purpose: expresses halo tagged PTEN protein
• Depositing Lab: Yimon Aye
• Publication: Fang et al J Am Chem Soc. 2013 Oct 2;135(39):14496-9. doi: 10.1021/ja405400k. Epub 2013 Sep 18.

Backbone

• Vector backbone: pMIR
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 6470
• Total vector size (bp): 8606
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: phosphatase and tensin homolog
• Alt name: PTEN
• Species: H. sapiens (human)
• Insert Size (bp): 2136
• GenBank ID: NM_000314.4
• Entrez Gene: PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
• Promoter: CMV
• Tag / Fusion Protein:
  • His-Halo-Tev (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Aye, Y.; Brignole, E. J.; Long, M. J. C.; Chitturulu, J.; Drennan, C. L.; Asturias, F. J.;
Stubbe J. Chem. Biol. 2012, 19, 799-805

Yen, H-C.S., Xu, Q., Chou, D.M., Zhao, Z., and Elledge, S.J. (2008). Global protein stability
profiling in mammalian cells. Science 322, 918−923.