pFGL822-8
(Plasmid
#58226)
-
PurposeFor fungal transformation via ATMT. Transformants to be selected by bialaphos resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFGL815
-
Modifications to backboneBialaphos resistance (Bar) cassette (0.9kb) has been cloned into pFGL815 (Addgene 52322) between Pst1 and Sal1 sites.
-
Vector typeBacterial Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephosphinothricin acetyl transferase
-
Alt namebialaphos resistance (Bar) gene
-
SpeciesStreptomyces sp.
-
Insert Size (bp)945
-
GenBank IDAF013602
- Promoter Aspergillus nidulans trpC promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GATCCTCGAGTGATATTGAAGGAGCACTTTTTGGGC
- 3′ sequencing primer CTGGTCGACCTAAATCTCGGTGACGGGCAGGACCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypCB1530 from FGSC (Fungal Genetics Stock Center).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference:
Sweigard J, Chumley F, Carroll A, Farrall L, Valent B (1997) A series of vectors for fungal transformation. Fungal Genet Newsl 44: 52-53
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFGL822-8 was a gift from Naweed Naqvi (Addgene plasmid # 58226 ; http://n2t.net/addgene:58226 ; RRID:Addgene_58226) -
For your References section:
A series of vectors for fungal transformation. Sweigard JA, Chumley F, Carroll A, Farrall L, Valent B. Fungal Genetics Reports, 1997. Vol. 44, Article 19 10.4148/1941-4765.1287