pCMV CEPIA2mt
(Plasmid #58218)

• Purpose: Green fluorescent indicator for calcium imaging in the mitochondria
• Depositing Lab: Masamitsu Iino
• Publication: Suzuki et al Nat Commun. 2014 Jun 13;5:4153. doi: 10.1038/ncomms5153.

Backbone

• Vector backbone: pCMV/myc/mito
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4799
• Total vector size (bp): 6404
• Modifications to backbone: Duplicate mitochondria targeting sequence.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CEPIA2mt
• Alt name: green fluorescent calcium-measuring organelle-entrapped protein indicator for the mitochondria
• Species: Synthetic
• Insert Size (bp): 1605
• Mutation: GCaMP2 N263Y E282V M339L
• Promoter: CMV
• Tag / Fusion Protein:
  • myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry