pCMV R-CEPIA1er
(Plasmid #58216)

• Purpose: Red fluorescent indicator for calcium signaling in the endoplasmic reticulum
• Depositing Lab: Masamitsu Iino
• Publication: Suzuki et al Nat Commun. 2014 Jun 13;5:4153. doi: 10.1038/ncomms5153.

Backbone

• Vector backbone: pCMV/myc/ER
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4819
• Total vector size (bp): 6302
• Modifications to backbone: None.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: R-CEPIA1er
• Alt name: red fluorescent calcium-measuring organelle-entrapped protein indicator for the endoplasmic reticulum
• Species: Synthetic
• Insert Size (bp): 1483
• Mutation: R-GECO1 E300D M305L D329N F332I E336D N346K F361W G370S E373D D380N V396E D402E
• Promoter: CMV
• Tag / Fusion Protein:
  • myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: None (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• Articles Citing this Plasmid:
  • 44 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry