AAV-hSyn-Lyn-Y-GECO1
(Plasmid #58200)

• Purpose: Express the membrane targeted Y-GECO1 in neurons
• Depositing Lab: Robert Campbell
• Publication: Zhao et al Integr Biol (Camb). 2014 May 19.

Backbone

• Vector backbone: AAV with hSyn promoter
• Backbone size w/o insert (bp): 4563
• Total vector size (bp): 5895
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Y-GECO1.0
• Alt name: A yellow fluorescent calcium ion indicator with inverted fluorescent response
• Species: Synthetic
• Insert Size (bp): 1332
• GenBank ID: KJ193859
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GAG GAG TCG TGT CGT GCC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry