pcDNA SF-HERC2 F6
(Plasmid #55789)

• Purpose: Expresses N-terminal 3xFLAG/STREP tagged HERC2 (4421-4834aa)
• Depositing Lab: David Chan
• Publication: Chan et al J Biol Chem. 2014 May 22. pii: jbc.M114.569392.

Backbone

• Vector backbone: pcDNA3.1+
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 6870
• Modifications to backbone: The following sequence encoding 3xFLAG/STREP tag was cloned into the NheI/BamHI sites of pcDNA3.1(+): GCTAGCACGCGTCCACCATG gactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaag GGGTCGGCCTGGAGCCACCCGCAGTTCGAAAAA GGATCC
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xFLAG tagged HERC2 (4421-4834aa)
• Alt name: HERC2
• Species: H. sapiens (human)
• Insert Size (bp): 1369
• GenBank ID: NM_004667.5
• Entrez Gene: HERC2 (a.k.a. D15F37S1, MRT38, SHEP1, jdf2, p528)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • STREP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: CGC AAA TGG GCG GTA GGC GTG
• 3′ sequencing primer: TAG AAG GCA CAG TCG AGG C

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry