-
PurposeProduces T7 RNA Polymerase.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZS4
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7 RNA Polymerase
-
SpeciesEscherichia coli
-
Insert Size (bp)2652
- Promoter pBAD
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCCCTGCTGCGTAACATCGTT
- 3′ sequencing primer GCGATGCTGCTTATCGAATCAAAGCT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUsed pTara's (Dr. Kathleen Matthews) T7 RNAP and AraC.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS6 was a gift from Matthew Bennett (Addgene plasmid # 55752 ; http://n2t.net/addgene:55752 ; RRID:Addgene_55752) -
For your References section:
Stable maintenance of multiple plasmids in E. coli using a single selective marker. Schmidt CM, Shis DL, Nguyen-Huu TD, Bennett MR. ACS Synth Biol. 2012 Oct 19;1(10):445-50. doi: 10.1021/sb3000589. Epub 2012 Sep 4. 10.1021/sb3000589 PubMed 23656183