pCS5
(Plasmid #55750)

• Purpose: Produces one half (beta) of aminoglycoside phosphotransferase (3′)-IIa when in the presence of T7 RNA Polymerase.
• Depositing Lab: Matthew Bennett
• Publication: Schmidt et al ACS Synth Biol. 2012 Oct 19;1(10):445-50. doi: 10.1021/sb3000589. Epub 2012 Sep 4.

Backbone

• Vector backbone: pBR322
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 4361
• Total vector size (bp): 4630
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Growth instructions: Deleted AmpR
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KanR
• Alt name: Neo
• Species: Escherichia coli
• Insert Size (bp): 816
• Mutation: Residues 59-264 of KanR
• GenBank ID: NC_012690.1
• Promoter: T7-lac

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCGACACGGAAATGTTGAATAC
• 3′ sequencing primer: TCACTGATGCCTCCGTGTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Split protein developed by Dr. Marc Ostermeier.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry