Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS1
(Plasmid #55749)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55749 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR322
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 4361
  • Total vector size (bp) 5262
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KanR
  • Alt name
    Neo
  • Species
    Escherichia coli
  • Insert Size (bp)
    816
  • GenBank ID
    NC_012690.1
  • Promoter T7-lac

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCGACACGGAAATGTTGAATAC
  • 3′ sequencing primer TCACTGATGCCTCCGTGTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS1 was a gift from Matthew Bennett (Addgene plasmid # 55749 ; http://n2t.net/addgene:55749 ; RRID:Addgene_55749)
  • For your References section:

    Stable maintenance of multiple plasmids in E. coli using a single selective marker. Schmidt CM, Shis DL, Nguyen-Huu TD, Bennett MR. ACS Synth Biol. 2012 Oct 19;1(10):445-50. doi: 10.1021/sb3000589. Epub 2012 Sep 4. 10.1021/sb3000589 PubMed 23656183