-
PurposeCre-off/Flp-on EYFP under the Synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 4536
- Total vector size (bp) 5854
-
Vector typeMammalian Expression, AAV ; Cre off/Flp on eYFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeYFP with introns
-
SpeciesSynthetic
-
Insert Size (bp)1310
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ccacgcgaggcgcgagatag
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn Coff/FonEYFP was a gift from Karl Deisseroth (Addgene plasmid # 55652 ; http://n2t.net/addgene:55652 ; RRID:Addgene_55652) -
For your References section:
Targeting cells with single vectors using multiple-feature Boolean logic. Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K. Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 2014 Jun 8. 10.1038/nmeth.2996 PubMed 24908100