Skip to main content
Addgene

pAAV-Ef1a-dDIO hChR2(H134R)-EYFP
(Plasmid #55640)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55640 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 7253
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hChR2(H134R)-EYFP
  • Species
    Synthetic
  • Insert Size (bp)
    1662
  • Promoter Ef1a
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-dDIO hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 55640 ; http://n2t.net/addgene:55640 ; RRID:Addgene_55640)

  • For your References section:

    Targeting cells with single vectors using multiple-feature Boolean logic. Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K. Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 2014 Jun 8. 10.1038/nmeth.2996 PubMed 24908100
Related items:
Commonly requested with: