Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

iDuet101a-mCHF1
(Plasmid #55611)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55611 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    iDuet101a
  • Backbone manufacturer
    Addgene#17629
  • Backbone size w/o insert (bp) 11426
  • Total vector size (bp) 12624
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Hey2
  • Alt name
    Chf1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1192
  • GenBank ID
    NM_013904.1
  • Entrez Gene
    Hey2 (a.k.a. CHF1, Herp1, Hrt2, bHLHb32, hesr2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GTTTGGATCTTGGTTCATTC
  • 3′ sequencing primer TCGTTAACCTCGAGTGTAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vector iDuet101a was purchased from Addgene #17629

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    iDuet101a-mCHF1 was a gift from Michael Chin (Addgene plasmid # 55611 ; http://n2t.net/addgene:55611 ; RRID:Addgene_55611)
  • For your References section:

    An optimized and simplified system of mouse embryonic stem cell cardiac differentiation for the assessment of differentiation modifiers. Hartman ME, Librande JR, Medvedev IO, Ahmad RN, Moussavi-Harami F, Gupta PP, Chien WM, Chin MT. PLoS One. 2014 Mar 25;9(3):e93033. doi: 10.1371/journal.pone.0093033. eCollection 2014. 10.1371/journal.pone.0093033 PubMed 24667642