pFastBac TEV SNAPf Prescission TwinStrepII cloning vector with BioBrick polycistronic restriction sites (11-SNAP-V3)
(Plasmid #55217)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: Gradia et al Methods Enzymol. 2017;592:1-26. doi: 10.1016/bs.mie.2017.03.008. Epub 2017 May 15.

Backbone

• Vector backbone: pFastBac
• Vector type: Insect Expression
• Tags / Fusion Proteins:
  • SNAPf (C terminal on backbone)
  • TwinStrepII (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: LicBac dual V1 F (5'-cctataactattccggattattcataccgtc-3')
• 3′ sequencing primer: LicBac dual V1 Rv (5'-caggttcagggggaggtgtg-3')

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.This vector has a TEV cleavable TwinStrepII-Prescission-Snapf tag on the C-terminus.

Add the following tags to your PCR primers:

LicV3 Forward Tag TTTAAGAAGGAGATATAGTTC (ORF needs to have ATG)
LicV3 Reverse Tag GGATTGGAAGTAGAGGTTCTC

Linearize this plasmid with HpaI and gel purify the product, then T4-treat
with dCTP. For the PCR product, T4-treat with dGTP.Series 11 vectors have
BioBrick restriction sites to facilitate subcloning reactions to make
polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the
restriction enzyme sites that flank your open reading frame. For more
information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/