-
PurposeSynthetic promoter responsive to gRNA1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL2-Luc (Addgene #26280)
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4215
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEYFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)702
-
GenBank IDKJ796488
- Promoter Minimal Ade MLP
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCC
- 3′ sequencing primer AGTGCGGCGACGATAGTCATGCCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see http://www.rle.mit.edu/sbg/resources/ for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P1-EYFP-pA (Construct 5) was a gift from Timothy Lu (Addgene plasmid # 55197 ; http://n2t.net/addgene:55197 ; RRID:Addgene_55197) -
For your References section:
Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. 10.1016/j.molcel.2014.04.022 PubMed 24837679