Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBS3Clux
(Plasmid #55172)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55172 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAH328
  • Backbone manufacturer
    Schmalisch et al, 2010
  • Vector type
    Synthetic Biology ; Bacillus BioBrick Box
  • Promoter none
  • Selectable markers
    chloramphenicol resistance in B. subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains the luxABCDE-operon from Photorabdus luminescence with all RBSs adjusted for use in B. subtilis. Allows the measurement of promoter activities based on transcriptional fusions and mediates chloramphenicol resistance. Integrates into the sacA locus.

For sequencing of inserts, use the following primers:
fwd: GAGCGTAGCGAAAAATCC
rev: GAAATGATGCTCCAGTAACC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS3Clux was a gift from Thorsten Mascher (Addgene plasmid # 55172 ; http://n2t.net/addgene:55172 ; RRID:Addgene_55172)
  • For your References section:

    The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Radeck J, Kraft K, Bartels J, Cikovic T, Durr F, Emenegger J, Kelterborn S, Sauer C, Fritz G, Gebhard S, Mascher T. J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29. 10.1186/1754-1611-7-29 PubMed 24295448