pBS4S
(Plasmid #55170)

• Purpose: (Empty Backbone) Empty vector, integration at thrC, ampr, specr
• Depositing Lab: Thorsten Mascher
• Publication: Radeck et al J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29.

Backbone

• Vector backbone: pDG1731
• Backbone manufacturer: Guerout-Fleury, et al. 1996
• Modifications to backbone: The erm-resistance outside of the integrative part of pDG1731 was removed via cut-ligation with MluI and BssHI, resulting in a 4.7 kb vector. The PstI site in bla was removed by site directed mutagenesis. The PstI site in thrB was removed performing site-directed mutagenesis. The spc-promoter with upstream PstI-overhang was amplified and cut with PstI and PciI. The MCS was cut from pSB1C3 with EcoRI and PstI. The vector was cut with EcoRI and PciI and the 4.3 kb-fragment ligated with both cut DNA-fragments. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis.
• Vector type: Synthetic Biology ; Bacillus BioBrick Box
• Promoter: none
• Selectable markers: spectinomycin resistance in B. subtilis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme

Resource Information

• Supplemental Documents:
  • pBS4S genbank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli.
For sequencing of inserts, use the following primers:
fwd: CGCTCAAGCTGTCATGTACG
rev: CGTATGTATTCAAATATATCCTCCTCAC