-
Purpose(Empty Backbone) Empty vector, integration at thrC, ampr, specr
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55170 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDG1731
-
Backbone manufacturerGuerout-Fleury, et al. 1996
-
Modifications to backboneThe erm-resistance outside of the integrative part of pDG1731 was removed via cut-ligation with MluI and BssHI, resulting in a 4.7 kb vector. The PstI site in bla was removed by site directed mutagenesis. The PstI site in thrB was removed performing site-directed mutagenesis. The spc-promoter with upstream PstI-overhang was amplified and cut with PstI and PciI. The MCS was cut from pSB1C3 with EcoRI and PstI. The vector was cut with EcoRI and PciI and the 4.3 kb-fragment ligated with both cut DNA-fragments. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis.
-
Vector typeSynthetic Biology ; Bacillus BioBrick Box
- Promoter none
-
Selectable markersspectinomycin resistance in B. subtilis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli.
For sequencing of inserts, use the following primers:
fwd: CGCTCAAGCTGTCATGTACG
rev: CGTATGTATTCAAATATATCCTCCTCAC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS4S was a gift from Thorsten Mascher (Addgene plasmid # 55170 ; http://n2t.net/addgene:55170 ; RRID:Addgene_55170) -
For your References section:
The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Radeck J, Kraft K, Bartels J, Cikovic T, Durr F, Emenegger J, Kelterborn S, Sauer C, Fritz G, Gebhard S, Mascher T. J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29. 10.1186/1754-1611-7-29 PubMed 24295448
Map uploaded by Addgene staff.
