pBS1C
(Plasmid #55168)

• Purpose: (Empty Backbone) Empty vector, integration at amyE, ampr, cmr
• Depositing Lab: Thorsten Mascher
• Publication: Radeck et al J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29.

Backbone

• Vector backbone: pDG1662
• Backbone manufacturer: Guerout-Fleury, et al. 1996
• Modifications to backbone: pDG1662blamut was cut with PstI to remove one XbaI site and the spcR outside of the integrative part. The 6 kb fragment was religated. The remaining PstI site was mutated via site-directed mutagenesis. To insert the MCS, the vector was cut with EcoRI. The MCS was amplified by PCR from pSB1C3, cut with EcoRI and BsaI (EcoRI-compatible overhang) and ligated into the vector. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis.
• Vector type: Synthetic Biology ; Bacillus BioBrick Box
• Selectable markers: chloramphenicol resistance in B. subtilis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme

Resource Information

• Supplemental Documents:
  • pBS1C-[RFP] genbank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli.
For sequencing of inserts, use the following primers:
fwd: AAAGGTCATTGTTGACGCGG
rev: GAGCGTAGCGAAAAATCC