Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRiboI SapNde
(Plasmid #54490)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 54490 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMV306
  • Backbone manufacturer
    W. R. Jacobs
  • Backbone size (bp) 4296
  • Modifications to backbone
    XbaI-NdeI insertion of hsp60 promoter, theophylline riboswitch, and SapI restriction site.
  • Promoter hsp60

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Shuttle vector: multi-copy episomal in E. coli, single-copy integrating in mycobacteria.
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCCTTTGAGTGAGCTGATACC
  • 3′ sequencing primer CTAGCTGATCACCGCGGCCATGATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRiboI SapNde was a gift from Jessica Seeliger (Addgene plasmid # 54490 ; http://n2t.net/addgene:54490 ; RRID:Addgene_54490)