pCRUSH
(Plasmid #54480)

• Purpose: (Empty Backbone) Mouse genomic ROSA26 targeting vector, expresses EGFP, cre/lox conditional U6 promoter pgk-puro
• Depositing Lab: Laurie Jackson-Grusby
• Publication: Brown et al Genesis. 2014 Jan;52(1):39-48. doi: 10.1002/dvg.22718. Epub 2013 Oct 26.

Backbone

• Vector backbone: ROSA26-1
• Backbone manufacturer: Phil Soriano, Addgene Plasmid #21714
• Modifications to backbone: Modified by deleting the HpaI site, converting the XhoI site to AscI, and cloning a splice acceptor-GFP-polyA into the XbaI site. Cre-lox regulated U6 cassette derived from pSICO PGK puro, Addgene plasmid 11586, (Ventura et al., 2004) was modified by replacing the lentiviral GFP gene with drug selection markers (pgk-puro), and cloned into the XbaI site 3' of GFP. Unique HpaI and XhoI sites were maintained for single step short hairpin oligonucleotide cloning.
• Vector type: Mammalian Expression, Mouse Targeting, RNAi, Cre/Lox
• Promoter: U6
• Selectable markers: Puromycin
• Tags / Fusion Proteins:
  • SA-EGFP-polyA (N terminal on backbone)
  • U6 promoter (N terminal on backbone)
  • loxP (N terminal on backbone)
  • pgk-puro (N terminal on backbone)
  • loxP (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CRUSH-for CATCAGAAGCTGGTCGACTCT
• 3′ sequencing primer: CRUSH-rev GGGCCACAACTCCTCATAAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Unique HpaI and XhoI sites were maintained for single step short hairpin oligonucleotide cloning.

Using the primers described above yields 429 bp and 374 bp for positive and negative products, respectively.